Table 3.

Genotype in NHANES III and AASK participants for each of the CRP polymorphisms

Genotype Frequency (%)
rs2808630rs1205rs3093066rs1417938rs3093058rs1800947a
AAAGGGGGAGAACCACAAAAATTTAAATTTGGCGCC
NHANES74242623345836676232712739820
AASK69283673036117577211663149820
  • a Data for rs1800947 are for all NHANES III African-Americans participants with DNA (n = 2108) beause the data user agreement does not allow outputs with counts less than 5.